View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0793_high_9 (Length: 226)
Name: NF0793_high_9
Description: NF0793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0793_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 121 - 200
Target Start/End: Complemental strand, 4046865 - 4046786
Alignment:
| Q |
121 |
tattattcgtatcgcggttgttcctgattccaatggtgagaaaattcttgataaattcagctcttgttaccctatctctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4046865 |
tattattcgtatcgcggttgttcctgattccaatggtgagaaaattcttgataaatttagctcttgttaccctatctctg |
4046786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 200
Target Start/End: Original strand, 3753409 - 3753452
Alignment:
| Q |
157 |
tgagaaaattcttgataaattcagctcttgttaccctatctctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3753409 |
tgagaaaattcttgataaattcagctcttgttaccctgtctctg |
3753452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 53 - 112
Target Start/End: Complemental strand, 5176388 - 5176328
Alignment:
| Q |
53 |
ttgttttccttctctttttgcaagtttgcatgag-ttttattttccctttgctttggtatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
5176388 |
ttgttttccttctctttttgcaagtttgtatgagttttttttttccctttgctttggtatc |
5176328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7182 times since January 2019
Visitors: 5775