View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0793_low_14 (Length: 367)
Name: NF0793_low_14
Description: NF0793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0793_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 81 - 233
Target Start/End: Complemental strand, 30780699 - 30780547
Alignment:
Q |
81 |
atggtaatatcaatattattgtacttgaaacctttagcaagagatatcttcagcacacaactcttgttcgcaagcagacaaagtgaaaccaaa-aggaaa |
179 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
T |
30780699 |
atggtaatatcaatattattgtacttgaaacctttagcaagagatatcttcagcacacaactcttgttcgcaagcaggcaaagtgaaaccaaagaggaaa |
30780600 |
T |
 |
Q |
180 |
atatcatgccacgacacccccaagtccccacatacatcctaattgttatggttc |
233 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
30780599 |
atatcatgccacgacaccccc-agtccccacatacatcctaattgttatggttc |
30780547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University