View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0793_low_15 (Length: 361)

Name: NF0793_low_15
Description: NF0793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0793_low_15
NF0793_low_15
[»] chr4 (1 HSPs)
chr4 (83-240)||(43033379-43033536)


Alignment Details
Target: chr4 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 83 - 240
Target Start/End: Complemental strand, 43033536 - 43033379
Alignment:
83 cacagatcgactactttaaacctatcttagagcgtgttggctctactccatcttgttacgcagattgattttatttaggtcttgtcttttatgcagattg 182  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43033536 cacagatcgactactttatacctatcttagagcgtgttggctctactccatcttgttacgcagattgattttatttaggtcttgtcttttatgcagattg 43033437  T
183 gctttactttaaatcctatttacctcctctccaattgaacacccttgcaactgcatca 240  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
43033436 gctttacttgaaatcctatttacctcctctccaattgaacacccttgcaactgcatca 43033379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 6939 times since January 2019
Visitors: 5773