View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0793_low_17 (Length: 318)

Name: NF0793_low_17
Description: NF0793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0793_low_17
NF0793_low_17
[»] chr7 (2 HSPs)
chr7 (165-244)||(4046786-4046865)
chr7 (201-244)||(3753409-3753452)
[»] chr3 (1 HSPs)
chr3 (97-156)||(5176328-5176388)


Alignment Details
Target: chr7 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 165 - 244
Target Start/End: Complemental strand, 4046865 - 4046786
Alignment:
165 tattattcgtatcgcggttgttcctgattccaatggtgagaaaattcttgataaattcagctcttgttaccctatctctg 244  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
4046865 tattattcgtatcgcggttgttcctgattccaatggtgagaaaattcttgataaatttagctcttgttaccctatctctg 4046786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 244
Target Start/End: Original strand, 3753409 - 3753452
Alignment:
201 tgagaaaattcttgataaattcagctcttgttaccctatctctg 244  Q
    ||||||||||||||||||||||||||||||||||||| ||||||    
3753409 tgagaaaattcttgataaattcagctcttgttaccctgtctctg 3753452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 97 - 156
Target Start/End: Complemental strand, 5176388 - 5176328
Alignment:
97 ttgttttccttctctttttgcaagtttgcatgag-ttttattttccctttgctttggtatc 156  Q
    |||||||||||||||||||||||||||| ||||| |||| |||||||||||||||||||||    
5176388 ttgttttccttctctttttgcaagtttgtatgagttttttttttccctttgctttggtatc 5176328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University