View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0793_low_20 (Length: 306)

Name: NF0793_low_20
Description: NF0793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0793_low_20
NF0793_low_20
[»] chr3 (2 HSPs)
chr3 (2-130)||(8465525-8465653)
chr3 (1-30)||(8465666-8465695)


Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 2 - 130
Target Start/End: Complemental strand, 8465653 - 8465525
Alignment:
2 gtgattaacaataaacaaacatcataattcataatggtagtaggtgttggatttttgtgctatatttgatacaataagtggctcatttcgatgcttctct 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8465653 gtgattaacaataaacaaacatcataattcataatggtagtaggtgttggatttttgtgctatatttgatacaataagtggctcatttcgatgcttctct 8465554  T
102 cttcatcattcattcactcactctctgtg 130  Q
     ||||||||||||||||||||||||||||    
8465553 gttcatcattcattcactcactctctgtg 8465525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 8465695 - 8465666
Alignment:
1 ggtgattaacaataaacaaacatcataatt 30  Q
    ||||||||||||||||||||||||||||||    
8465695 ggtgattaacaataaacaaacatcataatt 8465666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University