View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0793_low_21 (Length: 304)
Name: NF0793_low_21
Description: NF0793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0793_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 75 - 256
Target Start/End: Complemental strand, 36154550 - 36154369
Alignment:
| Q |
75 |
gtttggtggtgtttttgtttttatttcttgcagggtgtagtcaatgatcggtttaatgcgattgtatgtttgaataacaccgtggaacgaagagagcgtg |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36154550 |
gtttggtggtgtttttgtttttatttcttgcagggtgtagtgaatgatcggtttaatgcgattgtatgtttgaataacaccgtggaacgaagagagcgtg |
36154451 |
T |
 |
| Q |
175 |
ttgtgcagcagatagaaacatattttgctgatgttgacatgatccttactgagatttcacttgatgtgtaatgtctctgctc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36154450 |
ttgtgcagcagatagaaacatattttgctgatgttgacatgatacttactgagatttcacttgatgtgtaatgtttctgctc |
36154369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 85 - 256
Target Start/End: Complemental strand, 36160270 - 36160099
Alignment:
| Q |
85 |
gtttttgtttttatttcttgcagggtgtagtcaatgatcggtttaatgcgattgtatgtttgaataacaccgtggaacgaagagagcgtgttgtgcagca |
184 |
Q |
| |
|
|||||| |||| ||||||||||||| || ||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
36160270 |
gttttttttttcatttcttgcagggcgttgtcaatgatcggtttaatgcgatggtaggtttgaataacaccgtggaacgacgagaccgtgttgtgcagca |
36160171 |
T |
 |
| Q |
185 |
gatagaaacatattttgctgatgttgacatgatccttactgagatttcacttgatgtgtaatgtctctgctc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
36160170 |
gatagaaacatattttgctgatgttgacatgatccttgctgagatttcacttgatttgtaatgtttctgctc |
36160099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University