View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0793_low_22 (Length: 288)
Name: NF0793_low_22
Description: NF0793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0793_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 52 - 140
Target Start/End: Complemental strand, 38920196 - 38920108
Alignment:
| Q |
52 |
gttgctatgttgtgatcaaacgcagaagaacgagtattgaaatgaagatgaatcaaagaatcacactccaatttgggattttgggtcac |
140 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
38920196 |
gttgccatgttgcgatcaaacgcagaagaacgagtattgaaatgaagatgaatcaaagaataacactccaatttgggattttaggtcac |
38920108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 204 - 243
Target Start/End: Complemental strand, 38920044 - 38920005
Alignment:
| Q |
204 |
taatctggatataattgagtaaaggcggcgattcatatca |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38920044 |
taatctggatataattgagtaaaggcggcgattcttatca |
38920005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7186 times since January 2019
Visitors: 5775