View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0793_low_24 (Length: 285)
Name: NF0793_low_24
Description: NF0793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0793_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 12 - 260
Target Start/End: Original strand, 43700712 - 43700960
Alignment:
Q |
12 |
tatacttgaaaggcttagatcaaagattaaggaacaattgagggtgatgtgaaatctttgtgaggtgactatattagaataatatatgcatgcatggtcc |
111 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
43700712 |
tatatttgaaaggcttagatcaaagattaaggaacaattgagggtgatgtgaaatctttgtgaggtgactatattagaata--atatgcatgcatggtcc |
43700809 |
T |
 |
Q |
112 |
atttgggaatttatataagttgttaccacctaaaaaataattacctgatagttgg--nnnnnnnnnnnnnnnnnctatcattaaagtgatgtgaatgact |
209 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
43700810 |
atttgggaatttatataagttgttaccacctaaaaaataattacctgatagttggtttttttattgatttttttttatcattaaagtgatgtgaatgact |
43700909 |
T |
 |
Q |
210 |
attttactcttgaggtttgaattttgactcttgaaaatagcaatagctgat |
260 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
43700910 |
attttactcttgatgtttgaattttgactcttgaaaatagcaatagctgat |
43700960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6293 times since January 2019
Visitors: 5767