View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0793_low_25 (Length: 284)
Name: NF0793_low_25
Description: NF0793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0793_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 8e-67; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 52 - 188
Target Start/End: Complemental strand, 26805402 - 26805266
Alignment:
| Q |
52 |
gttggaagcaccggcatcggcggtgcagaggcagatgggtgtggttgataaggataagccatgatgatagcgatgatatgaatgttatgttttgttatga |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26805402 |
gttggaagcaccggcatcggcggtgcagaggcagatggttgtggttgataaggataagccatgatgatagtgatgatatgaatgttatgttttgttatga |
26805303 |
T |
|
| Q |
152 |
acttatgatagctctttaattttaatttgtctctgtg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26805302 |
acttatgatagctctttaattttaatttgtctctgtg |
26805266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 52 - 113
Target Start/End: Complemental strand, 26824227 - 26824166
Alignment:
| Q |
52 |
gttggaagcaccggcatcggcggtgcagaggcagatgggtgtggttgataaggataagccat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
26824227 |
gttggaagcaccggcatcggcggtgcagaggcagatggttgtggttgacaaggataagccat |
26824166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 73 - 120
Target Start/End: Complemental strand, 26824134 - 26824087
Alignment:
| Q |
73 |
ggtgcagaggcagatgggtgtggttgataaggataagccatgatgata |
120 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
26824134 |
ggtgcagaggcagaaggttgtggttgataaggataagccatgatgata |
26824087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 72 - 121
Target Start/End: Complemental strand, 26836085 - 26836036
Alignment:
| Q |
72 |
cggtgcagaggcagatgggtgtggttgataaggataagccatgatgatag |
121 |
Q |
| |
|
||||||||||| ||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
26836085 |
cggtgcagaggaagaaggttgtggttgataaggataagccatgatgatag |
26836036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 62 - 118
Target Start/End: Complemental strand, 26800290 - 26800234
Alignment:
| Q |
62 |
ccggcatcggcggtgcagaggcagatgggtgtggttgataaggataagccatgatga |
118 |
Q |
| |
|
||||||||||||||||||| ||| || | ||||||||||||||||||||||| |||| |
|
|
| T |
26800290 |
ccggcatcggcggtgcagaagcatattgctgtggttgataaggataagccataatga |
26800234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 73 - 114
Target Start/End: Complemental strand, 26795488 - 26795447
Alignment:
| Q |
73 |
ggtgcagaggcagatgggtgtggttgataaggataagccatg |
114 |
Q |
| |
|
||||||||||||||||| |||| | ||||||||||||||||| |
|
|
| T |
26795488 |
ggtgcagaggcagatggctgtgctggataaggataagccatg |
26795447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6398 times since January 2019
Visitors: 5768