View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0793_low_28 (Length: 257)
Name: NF0793_low_28
Description: NF0793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0793_low_28 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 23 - 257
Target Start/End: Original strand, 29946122 - 29946357
Alignment:
Q |
23 |
atcatcatatccataccttctcaagaacatgggttcgggatagtgaactaagctggctgctttccatatttgcaagtaactgaacgacagtcttcagctg |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29946122 |
atcatcatatccataccttctcaagaacatgggttcgggatagtgaactaagctggctactttccatatttgcaagtaactgaacgacagtcttcagctg |
29946221 |
T |
 |
Q |
123 |
tggaacactacaaattcggaactcaaatcagcaatatat-aaaaacatatcctacactgatacaaagttaaaagaaaataactgcagcgacttcgaatca |
221 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29946222 |
tggaacactacaaattttgaactcaaatcagcaatatataaaaaacatatcctacactgatacaaagttaaaagaaaataactgcagcgacttcgaatca |
29946321 |
T |
 |
Q |
222 |
atgttgtcaaaatagcggctatagcttaacataatt |
257 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
29946322 |
atgttgtcaaaatagcggctatagcttaacataatt |
29946357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7158 times since January 2019
Visitors: 5774