View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0793_low_29 (Length: 256)
Name: NF0793_low_29
Description: NF0793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0793_low_29 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 150 - 256
Target Start/End: Complemental strand, 9609828 - 9609721
Alignment:
| Q |
150 |
gagaaaaggaagtatagtcattccaaatgttcgaaacgtgtaaaaatatnnnnnnn-tggcactgaggaattaaaaatcatatgtacaatggttaaaaga |
248 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9609828 |
gagaaaaggaagtatagtcaatccaaatgttcgaaacgtgtaaaaatattaaaaaaatggcactgaggaattaaaaatcatatgtacaatggttaaaaga |
9609729 |
T |
|
| Q |
249 |
aaatcaag |
256 |
Q |
| |
|
|||||||| |
|
|
| T |
9609728 |
aaatcaag |
9609721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6874 times since January 2019
Visitors: 5772