View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0793_low_32 (Length: 209)
Name: NF0793_low_32
Description: NF0793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0793_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 3895365 - 3895268
Alignment:
| Q |
1 |
ccttcttttgtcttatcagccatgtaactcgctccttccttggttctttcctttgcatcataagcataatctctagctttctccccagcactctctgc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3895365 |
ccttcttttgtcttatcagccatgtaactcgctccttccttggttctttcctttgcatcataagcataatctctagctttctccccagcactctctgc |
3895268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 37 - 95
Target Start/End: Complemental strand, 3895197 - 3895139
Alignment:
| Q |
37 |
tccttggttctttcctttgcatcataagcataatctctagctttctccccagcactctc |
95 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
3895197 |
tcctttgttctctcctttgcatcataagcataatctctagccttctctccagcattctc |
3895139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 35 - 98
Target Start/End: Complemental strand, 3895079 - 3895016
Alignment:
| Q |
35 |
cttccttggttctttcctttgcatcataagcataatctctagctttctccccagcactctctgc |
98 |
Q |
| |
|
|||| |||||||| || ||| | ||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
3895079 |
cttcattggttctgtcttttacctcataagcatagtctctagctttctctccagcattctctgc |
3895016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University