View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0794_high_13 (Length: 224)
Name: NF0794_high_13
Description: NF0794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0794_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 38286772 - 38286564
Alignment:
| Q |
1 |
ttgccccacgtactccttgtacacacacattgtcccacacacatacatacaatatgcctgcttatattatgagatattctcatcagaccgccagggtcac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38286772 |
ttgccccacgtactccttgtacacacacattgtcccacacacatacatacaatatgcctgcttatattatgagatattctcatcagatcgccagggtcac |
38286673 |
T |
|
| Q |
101 |
gatagcaaagggttgatcatgatagattggtatttgaaaatgatctcaaatatgaattgtatgattctcctcagtccaatcacacgatatacgatatata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38286672 |
gatagcaaagggttgatcatgatagattggtatttgaaaatgatctcaaatatgaattgtatgattctcctcagtccaatcacacgatatacgatatata |
38286573 |
T |
|
| Q |
201 |
gttttcctc |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
38286572 |
gttttcctc |
38286564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 81 times since January 2019
Visitors: 5847