View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0794_high_14 (Length: 213)
Name: NF0794_high_14
Description: NF0794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0794_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 29662147 - 29661963
Alignment:
Q |
1 |
ggtggcagtagcaagcaagagaaaggtttttgggattggattgttggtggtttaacaaaagaagatcagttctatgaaactgatcctattctcaagaagg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29662147 |
ggtggcagtagcaagcaagagaaaggtttttgggattggattgttggtggtttaacaaaagaagatcagttctatgaaactgatcctattctcaagaagg |
29662048 |
T |
 |
Q |
101 |
ttgaagagaagaataatagtagaggcactactagtagaggtactactagtggtaaaggcactactggtggtggcaagaactctgt |
185 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
29662047 |
ttgaagagaagaataatagtagaggcactactagtagaggtactactagtggtaaaggcactactagtggtggcaagaactctgt |
29661963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University