View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0794_low_10 (Length: 425)
Name: NF0794_low_10
Description: NF0794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0794_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 395; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 395; E-Value: 0
Query Start/End: Original strand, 1 - 403
Target Start/End: Complemental strand, 52541965 - 52541563
Alignment:
| Q |
1 |
aggaagagggatgagatttttgttgatgtgattgaaaaaataagtctcacattcaattccagtgtaagtatgcaggtttatctcttacatgtttatgtcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52541965 |
aggaagagggatgagatttttgttgatgtgattgaaaaaataagtctcacattcaattccagtgtaagtatgcaggtttatctcttacatgtttatgtcg |
52541866 |
T |
|
| Q |
101 |
tcatgcaatctattacactgtctttcctcccttcttattgctgcaaaattttgaagctttgtgatgagttgtattgtttacaacagggatttatactcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52541865 |
tcatgcaatctattacactgtctttcctcccttcttattgctgcaaaattttgaagctttgtgatgagttgtattgtttacaacagggatttatactcac |
52541766 |
T |
|
| Q |
201 |
cagtgagattgatggtaccattcaaatgaagagttatcttactggtaacccagagattcgacttgctctcaatgaagacctgagtataggaacaaatggt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52541765 |
cagtgagattgatggtaccattcaaatgaagagttatcttactggtaacccagagattcgacttgctctcaatgaagacctgagtataggaacaagtggt |
52541666 |
T |
|
| Q |
301 |
aggtcaatcaatctatgttgactagttgatatcagttttcttgtttacccttccttctttcctgatttcattctattatctttaacagattacacaggtt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52541665 |
aggtcaatcaatctatgttgactagttgatatcagttttcttgtttacccttccttctttcctgatttcattctattatctttaacagattacagaggtt |
52541566 |
T |
|
| Q |
401 |
ctg |
403 |
Q |
| |
|
||| |
|
|
| T |
52541565 |
ctg |
52541563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 245
Target Start/End: Complemental strand, 27828684 - 27828643
Alignment:
| Q |
204 |
tgagattgatggtaccattcaaatgaagagttatcttactgg |
245 |
Q |
| |
|
|||||||||||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
27828684 |
tgagattgatggcaccatacaaatgaagagctatcttactgg |
27828643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 439 times since January 2019
Visitors: 5836