View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0794_low_11 (Length: 412)
Name: NF0794_low_11
Description: NF0794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0794_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 3e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 229 - 329
Target Start/End: Complemental strand, 275936 - 275836
Alignment:
Q |
229 |
tatatggtttcaagtgcaataatattttaatagttgattccattttgtattttatttaattaattaaagttatctataaatccaatacacgtcatatgat |
328 |
Q |
|
|
||||| || |||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| ||||||||| |
|
|
T |
275936 |
tatatagtctcaagtgcaatactattttaataattgattccattttgtattttatttaattaattaaagttatctgtaaatctaatacacatcatatgat |
275837 |
T |
 |
Q |
329 |
a |
329 |
Q |
|
|
| |
|
|
T |
275836 |
a |
275836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 356 - 404
Target Start/End: Complemental strand, 275443 - 275395
Alignment:
Q |
356 |
tatgataatagtctgcacatcaatagagttctaaacatttttctctgct |
404 |
Q |
|
|
||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
T |
275443 |
tatgataatagtccacacatcaatagagttctagacatttttctctgct |
275395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 276 - 310
Target Start/End: Original strand, 46662938 - 46662972
Alignment:
Q |
276 |
tattttatttaattaattaaagttatctataaatc |
310 |
Q |
|
|
||||||||||||||||||||||||||| ||||||| |
|
|
T |
46662938 |
tattttatttaattaattaaagttatccataaatc |
46662972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University