View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0794_low_13 (Length: 357)
Name: NF0794_low_13
Description: NF0794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0794_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 65 - 348
Target Start/End: Complemental strand, 42209597 - 42209315
Alignment:
| Q |
65 |
ccatgaacaaactaaatggattgatatatgtgatacgaaagacatggataacaattctcatcctattatatcaatggaagataaggaagcagtggtgttc |
164 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42209597 |
ccatgaacaaac-aaatggattgatatatgtgatacgaaagacatggataacaattctcatcctattatatcaatggaagataaggaagcagtgatgttc |
42209499 |
T |
|
| Q |
165 |
gaagaggaatacggggagtggtgcgctggtggtcatggccctaagtgcgacgatcaatttcaagatgcttgagtcaagactatatagtctttggatccat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42209498 |
gaagaggaatacggggagtggtgcgctggtggtcatggccctaagtgcgacgatcaatttcaagatgcttgagtcaagactatatagtctttggatccat |
42209399 |
T |
|
| Q |
265 |
aatggatcaatcaaaattacaaatttgtcgcgtaactatttttatggtannnnnnncctaagaggattacaaacatatattctt |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
42209398 |
aatggatcaatcaaaattacaaatttgtcgcgtaactatttttatggtatttttttcctaagaggattacaaacatattttctt |
42209315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 216 - 258
Target Start/End: Complemental strand, 19072774 - 19072732
Alignment:
| Q |
216 |
gatcaatttcaagatgcttgagtcaagactatatagtctttgg |
258 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
19072774 |
gatcaatttcaagatgctttagtcaagactatatggtctttgg |
19072732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 569 times since January 2019
Visitors: 5845