View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0794_low_18 (Length: 308)
Name: NF0794_low_18
Description: NF0794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0794_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 64 - 264
Target Start/End: Original strand, 1844457 - 1844658
Alignment:
Q |
64 |
ctgatatgaaaaccttatagttataaaccacnnnnnnnn-gtgatgtaatatgctcaactatatgctttttgaacatatgttctcaggtttacacaggtt |
162 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1844457 |
ctgatatgaaaaccttatagttataaaccactttttttttgtgatgtaatatgctcaactatatgctttttgaacatatgttctcaggtttacacaggtt |
1844556 |
T |
 |
Q |
163 |
tatttgataaactgatacctttggagtatagtatgtnnnnnnnnttaagatactggtactctttcacttcagtatactctactctcacttcaaaatcctt |
262 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1844557 |
tatttgataaactgatacctttggagtatagtatgtaaaaaaaattaagatactggtactctttcacttcagtatactctactctcacttcaaaatcctt |
1844656 |
T |
 |
Q |
263 |
tg |
264 |
Q |
|
|
|| |
|
|
T |
1844657 |
tg |
1844658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 41 times since January 2019
Visitors: 5846