View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0794_low_32 (Length: 213)

Name: NF0794_low_32
Description: NF0794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0794_low_32
NF0794_low_32
[»] chr5 (1 HSPs)
chr5 (1-185)||(29661963-29662147)


Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 29662147 - 29661963
Alignment:
1 ggtggcagtagcaagcaagagaaaggtttttgggattggattgttggtggtttaacaaaagaagatcagttctatgaaactgatcctattctcaagaagg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29662147 ggtggcagtagcaagcaagagaaaggtttttgggattggattgttggtggtttaacaaaagaagatcagttctatgaaactgatcctattctcaagaagg 29662048  T
101 ttgaagagaagaataatagtagaggcactactagtagaggtactactagtggtaaaggcactactggtggtggcaagaactctgt 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
29662047 ttgaagagaagaataatagtagaggcactactagtagaggtactactagtggtaaaggcactactagtggtggcaagaactctgt 29661963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University