View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0794_low_5 (Length: 489)
Name: NF0794_low_5
Description: NF0794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0794_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 8e-90; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 8e-90
Query Start/End: Original strand, 252 - 462
Target Start/End: Complemental strand, 43436752 - 43436547
Alignment:
| Q |
252 |
attaattgaatcaatcaatcaatcaggtactctcttcgcctcttctcactctcactgctgctactgctgcccaaatcatgtaagtaa-ttaattacttct |
350 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43436752 |
attaattgaatca-tcaatcaatcaggtactctcttcgcctcttctcactctcactgctgctgctgctgcccaaatcatgtaagtaatttaattacttct |
43436654 |
T |
 |
| Q |
351 |
ttctcaatcacccactgctctctactttaaaactaatttcaattcaattcaattcaattcttattaggagcaatacccattctgaagaatattgttcaat |
450 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43436653 |
ttctcaatcacccactgctctctactttacaactaat-----ttcaattcaattcaattcttattaggagcaatacccattctgaagaatattgttcaat |
43436559 |
T |
 |
| Q |
451 |
gtatgatatctg |
462 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43436558 |
gtatgatatctg |
43436547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 86 - 141
Target Start/End: Complemental strand, 43436922 - 43436867
Alignment:
| Q |
86 |
tgatgataatggattttcttgatatcatcgacttctcatcctcctccacttctgct |
141 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43436922 |
tgatgataatggattttcttggtatcatcgacttctcatcctcctccacttctgct |
43436867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 33 - 68
Target Start/End: Complemental strand, 43436975 - 43436940
Alignment:
| Q |
33 |
cctgtgcgtgttgatgatcaaacaaaaaatgtattt |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43436975 |
cctgtgcgtgttgatgatcaaacaaaaaatgaattt |
43436940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University