View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0794_low_6 (Length: 483)
Name: NF0794_low_6
Description: NF0794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0794_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 17 - 224
Target Start/End: Original strand, 7436208 - 7436415
Alignment:
| Q |
17 |
acacctgagggatgaatctagctagctaggcaatgatcttctttggtcccaagattccatttccatatctacttgatcaatggacacatgtcacatattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7436208 |
acacctgagggatgaatctagctagctaggcaatgatcttctttggtcccaagattccatttccatatctacttgatcaatggacacatgtcacatattt |
7436307 |
T |
|
| Q |
117 |
tatggctatcacatgtctcatttttgtataacacattaaattttctttgattaactcaattagtacccaatgttattatgaaatgtattggttttcagct |
216 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7436308 |
tatgcctatcacatgtctcatttttgtataacacattaaattttctttgattaactcaattagtacccaatgttattatgaaatgtattggttttcagct |
7436407 |
T |
|
| Q |
217 |
caacatat |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
7436408 |
caacatat |
7436415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 96; E-Value: 7e-47
Query Start/End: Original strand, 265 - 384
Target Start/End: Original strand, 7436456 - 7436575
Alignment:
| Q |
265 |
tcagtggcatccatgtgcataggccagtgacagtttacggaatgaaagacaagccagcttggaatcccttaaagagagtgnnnnnnnntggaactgaagg |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7436456 |
tcagtggcatccatgtgcataggccagtgacagtttacggaatgaaagacaagccagcttggaatcccttaaagagagtgaaaaaaaatggaactgaagg |
7436555 |
T |
|
| Q |
365 |
acgaaggaaggacacatacc |
384 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7436556 |
acgaaggaaggacacatacc |
7436575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 38 - 144
Target Start/End: Original strand, 7450323 - 7450429
Alignment:
| Q |
38 |
ctagctaggcaatgatc----ttctttggtcccaagattccatttccatatctacttgatcaatggacacatgtcacatattttatggctatcacatgtc |
133 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| || || | ||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7450323 |
ctagctaggcaatgatcgattttctttggtcccaagattccatttccacttcc-ctc---ccatggacacatgtcccatattttatgcctatcacatgtc |
7450418 |
T |
|
| Q |
134 |
tcatttttgta |
144 |
Q |
| |
|
| ||||||||| |
|
|
| T |
7450419 |
ttatttttgta |
7450429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 423 times since January 2019
Visitors: 5836