View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_high_19 (Length: 379)
Name: NF0795_high_19
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0795_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 1e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 30 - 209
Target Start/End: Original strand, 8807510 - 8807689
Alignment:
Q |
30 |
attttgatcaaaagggtggatgaatttgagcaagagaggtggaaagaacttgacaatgaagcacatgaagtgttgttgatgtagaatggaaatggaacat |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8807510 |
attttgatcaaaagggtggatgaatttgagcaagagaggtggaaagaacttgacaatgaagcacatgaagtgttgttgatgtagaatggaaatggaacat |
8807609 |
T |
 |
Q |
130 |
ggagttttccacatgtttcattgcatgaattttttggaagcataggtggttcaactagttttgtttgcacttgttggagg |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
8807610 |
ggagttttccacatgtttcattgcatgaattttttggaagcaaaggtggttcaactagttttgtttgcacttgttggagg |
8807689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 263 - 368
Target Start/End: Original strand, 8807743 - 8807848
Alignment:
Q |
263 |
tttcatgaggacaacaacattaaacattgctagtagcagtggcagtgacagtgctagtgaaagaacttgttgagtttaggtgttaaagaaaaaacaatgc |
362 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8807743 |
tttcatgaggacaacaacattaaacattgctagtagcagtggcagggacagtgctagtgaaagaacttgttgagtttaggtgttaaagaaaaaacaatgc |
8807842 |
T |
 |
Q |
363 |
gttcat |
368 |
Q |
|
|
|||||| |
|
|
T |
8807843 |
gttcat |
8807848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 192 times since January 2019
Visitors: 5832