View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_high_32 (Length: 321)
Name: NF0795_high_32
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0795_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 310; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 310; E-Value: 1e-175
Query Start/End: Original strand, 1 - 310
Target Start/End: Original strand, 46040699 - 46041008
Alignment:
| Q |
1 |
gagttcgatgaattagtagaagccataatgccgaacatgaatgcagaagtattggtgaatcaagaacaacttataggtgtgttcaagtgcttcgatcgcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46040699 |
gagttcgatgaattagtagaagccataatgccgaacatgaatgcagaagtattggtgaatcaagaacaacttataggtgtgttcaagtgcttcgatcgcg |
46040798 |
T |
 |
| Q |
101 |
atgggaatggattcatttcagcagctgaattggctggagcaatggctaaaatgggtcagccacttacatacaaagagcttattgagatgattagagaggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46040799 |
atgggaatggattcatttcagcagctgaattggctggagcaatggctaaaatgggtcagccacttacatacaaagagcttattgagatgattagagaggc |
46040898 |
T |
 |
| Q |
201 |
agatatggatggtgatggtgttattagttttagtgagtttgctactattatggctcgatctgcttctgatttattaggagtgtttgaatacagaaacaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46040899 |
agatatggatggtgatggtgttattagttttagtgagtttgctactattatggctcgatctgcttctgatttattaggagtgtttgaatacagaaacaaa |
46040998 |
T |
 |
| Q |
301 |
acacattcat |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
46040999 |
acacattcat |
46041008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 209 - 272
Target Start/End: Original strand, 29582364 - 29582427
Alignment:
| Q |
209 |
atggtgatggtgttattagttttagtgagtttgctactattatggctcgatctgcttctgattt |
272 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| ||| ||||| ||| ||| ||||||| |
|
|
| T |
29582364 |
atggtgatggtgttattagtttcaatgagtttgctaccattttggctaaatcagctgctgattt |
29582427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University