View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_high_33 (Length: 318)
Name: NF0795_high_33
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0795_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 3e-76; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 96 - 248
Target Start/End: Original strand, 29206960 - 29207112
Alignment:
Q |
96 |
aacttcatcatcattgccttcttgttcatcatcaactccattatcactatctctttctcacttagtattatcaatgtatcttttctttgtgatgtaggaa |
195 |
Q |
|
|
|||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29206960 |
aacttcatcaccattgccttcttgttcatcatcaaatccattatcactatctctttctcacttagtattatcaatgtatcttttctttgtgatgtaggaa |
29207059 |
T |
 |
Q |
196 |
acatgcaactacattgggtcaatttatagagtgcaaccaggggtatatatgtc |
248 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29207060 |
acatgcaactacattgggtcaatttatagagtgcaaccaggggtatatatgtc |
29207112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 96 - 158
Target Start/End: Original strand, 29158354 - 29158416
Alignment:
Q |
96 |
aacttcatcatcattgccttcttgttcatcatcaactccattatcactatctctttctcactt |
158 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
T |
29158354 |
aacttcatcatcattgccttcttgttcatcatcaacaccattatcactatctttttctcactt |
29158416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 151
Target Start/End: Original strand, 29153727 - 29153785
Alignment:
Q |
96 |
aacttcatcatcattgccttcttgttc---atcatcaactccattatcactatctcttt |
151 |
Q |
|
|
|||||||||| |||||||||||||||| |||||||||||||| | ||||||||||| |
|
|
T |
29153727 |
aacttcatcaccattgccttcttgttcttgttcatcaactccattgttactatctcttt |
29153785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 311
Target Start/End: Original strand, 29207147 - 29207175
Alignment:
Q |
283 |
gaaaagatgcattcatcacatgccttaca |
311 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
29207147 |
gaaaagatgcattcatcacatgccttaca |
29207175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1089 times since January 2019
Visitors: 5825