View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_high_34 (Length: 313)
Name: NF0795_high_34
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0795_high_34 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 6 - 307
Target Start/End: Complemental strand, 2150635 - 2150334
Alignment:
| Q |
6 |
cgaaggaatatgttgggcacgtcaacctttcttgtaacataaataaactgagtgaaggaaaatgccccaaaggtcaatgacaacgactttgttgtcctat |
105 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2150635 |
cgaaggaatatgtagggcacatcaacctttcttgtaacataaataaactgagtgaaggaaaatgccccaaaggtcaatgacaacgactttgttgtcctat |
2150536 |
T |
 |
| Q |
106 |
agttattttgtgtgtcaagttggttaaatatttaagagataaaatatttacaccattattttctgacaattttatctatcataatcatattatctttatc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2150535 |
agttattttgtgtgtcaagttggttaaatatttaagagataaaatatttacaccattattttatgacaattttatctatcataatcatattatctttatc |
2150436 |
T |
 |
| Q |
206 |
gttttgattttcgtgtcaatgtcgttannnnnnnnnnnnnngtaaaactatggttgacacgtaagttgtcaacaacctcatatccacattgatattcttc |
305 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
2150435 |
gttttgattttcgtgtcaatgtcgttattttttatttttttgtaaaactatggttgacacgtaagttgtcaacaacctcatatccacattgatgttattc |
2150336 |
T |
 |
| Q |
306 |
ga |
307 |
Q |
| |
|
|| |
|
|
| T |
2150335 |
ga |
2150334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University