View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0795_high_40 (Length: 286)

Name: NF0795_high_40
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0795_high_40
NF0795_high_40
[»] chr3 (1 HSPs)
chr3 (1-207)||(54852751-54852957)


Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 54852751 - 54852957
Alignment:
1 atccattagtagatgctttctagcattttcttttgtcgatcgtggcctgttagtggcttggagcgatatctaagatgcctaactccttggtcagctcagt 100  Q
    |||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54852751 atccattagtagatgcttcctagcattttcttttgtcgatcctggcctgttagtggcttggagcgatatctaagatgcctaactccttggtcagctcagt 54852850  T
101 tgtaactttgctgtgctggaaaccggaatttgtgcatgtgaaatggctttcttgattttggagcattgtgttgtgattttggagttggtagcaaggtgct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54852851 tgtaactttgctgtgctggaaaccggaatttgtgcatgtgaaatggctttcttgattttggagcattgtgttgtgattttggagttggtagcaaggtgct 54852950  T
201 ctctgtg 207  Q
    |||||||    
54852951 ctctgtg 54852957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University