View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_high_40 (Length: 286)
Name: NF0795_high_40
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0795_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 54852751 - 54852957
Alignment:
| Q |
1 |
atccattagtagatgctttctagcattttcttttgtcgatcgtggcctgttagtggcttggagcgatatctaagatgcctaactccttggtcagctcagt |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54852751 |
atccattagtagatgcttcctagcattttcttttgtcgatcctggcctgttagtggcttggagcgatatctaagatgcctaactccttggtcagctcagt |
54852850 |
T |
 |
| Q |
101 |
tgtaactttgctgtgctggaaaccggaatttgtgcatgtgaaatggctttcttgattttggagcattgtgttgtgattttggagttggtagcaaggtgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54852851 |
tgtaactttgctgtgctggaaaccggaatttgtgcatgtgaaatggctttcttgattttggagcattgtgttgtgattttggagttggtagcaaggtgct |
54852950 |
T |
 |
| Q |
201 |
ctctgtg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
54852951 |
ctctgtg |
54852957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University