View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_high_42 (Length: 283)
Name: NF0795_high_42
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0795_high_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 12 - 254
Target Start/End: Complemental strand, 36124784 - 36124542
Alignment:
| Q |
12 |
agagatcaaatccgactatattgtcaaaatagtcagaatcaattgaaaattaacaataaatttggatatttgttttgaatttcttatagtaataagtaag |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36124784 |
agagatcaaacccgactatattgtcaaaatagtcagaatcaattgaaaattaacaataaatttggatatttgttttgaatttcttatagtaataagtaag |
36124685 |
T |
|
| Q |
112 |
aacaaatcaaacactaattgcatacctgcaaaaacacttggatcctcatttctcaaaccttctggtattgcaccctccaattgattgttagataaattaa |
211 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36124684 |
aacaaataaaacactaattgcatacctgcaaaaacacttggatcctcatttctcaaaccttctggtattgcaccctccaattgattgttagataaattaa |
36124585 |
T |
|
| Q |
212 |
acactctgaaaccactctgtagaaaatctggtatattgccatc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36124584 |
acactctgaaaccactctgtagaaaatctggtatattgccatc |
36124542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 174 - 248
Target Start/End: Complemental strand, 1245799 - 1245725
Alignment:
| Q |
174 |
tggtattgcaccctccaattgattgttagataaattaaacactctgaaaccactctgtagaaaatctggtatatt |
248 |
Q |
| |
|
|||||||| ||||||||||||||||||||| || ||||| ||||||||| || | ||| |||| || |||||||| |
|
|
| T |
1245799 |
tggtattggaccctccaattgattgttagacaagttaaatactctgaaatcattttgttgaaattcaggtatatt |
1245725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 484 times since January 2019
Visitors: 5839