View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_high_50 (Length: 251)
Name: NF0795_high_50
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0795_high_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 28 - 203
Target Start/End: Complemental strand, 53410310 - 53410135
Alignment:
Q |
28 |
cttttaaaacaaaatttgaacgtgctaaaatttgtatggatatcagcataaaacaatttcaatacaaaatggcaagaaaatcgacatgacattaaattta |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||| |
|
|
T |
53410310 |
cttttaaaacaaaatttgaacgtgctaaaatttgtatggatatcagcataaaacaatttcaatacaaaattgcaagaaaatcgacaagtcattaaattta |
53410211 |
T |
 |
Q |
128 |
aaaagtattgaaaaccgtaggaaaatcaattgaaaacatatttttgtgaataaccataaaagattgggcaggttgt |
203 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53410210 |
aaaagtattagaaaccgtaggaaaatcaattgaaaacatatttttgtgaataaccataaaagattgggcaggttgt |
53410135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 206 times since January 2019
Visitors: 5832