View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_high_53 (Length: 237)
Name: NF0795_high_53
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0795_high_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 31192623 - 31192831
Alignment:
| Q |
15 |
cataggcacaacaaaagagcaaaagagggtcaaatttctgtgcttgaattatcttttgtagggactatgcaatatccttccagaaaataacattatatcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31192623 |
cataggcacaacaaaagagcaaaagagggtcaaatttctgtgcttgaattatcttttgtagggactatgcaatatccttccagaaaataacattatatcc |
31192722 |
T |
|
| Q |
115 |
actgtgctatatggtttttaagaaatagtttctgcaatgaggtttatatcaatgttataggcatttgatgtgcaggga---cgtacttgaagtttgcgta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
31192723 |
actgtgctatatggtttttaagaaatagtttctgcaatgaggtttatatcaatgttataggcatttgatgtgcagggacgccgcacttgaagtttgcgta |
31192822 |
T |
|
| Q |
212 |
tattttctg |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
31192823 |
aattttctg |
31192831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 31014370 - 31014574
Alignment:
| Q |
15 |
cataggcacaacaaaagagcaaaagagggtcaaatttctgtgcttgaattatcttttgtagggactatgcaatatccttccagaaaataacattatatcc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
31014370 |
cataggcacaacaaaagagcaaaagagggtcaaatttctgtgcttgaattatcttttgtagggactatgacatatccttcaagaaaataacattatatcc |
31014469 |
T |
|
| Q |
115 |
actgtgctatatggtttttaagaaatagtttctgcaatgaggtttatatcaatgttataggcatttgatgtgcagggacgtacttgaagtttgcgtatat |
214 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31014470 |
actgtgctatat-gtatttaagaaatagtttctgcagtgtagtttatatcaatgttataggcatttgatgtgcagggacgtacttgaagtttgcgtatat |
31014568 |
T |
|
| Q |
215 |
tttctg |
220 |
Q |
| |
|
|||||| |
|
|
| T |
31014569 |
tttctg |
31014574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 429 times since January 2019
Visitors: 5836