View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0795_high_55 (Length: 234)

Name: NF0795_high_55
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0795_high_55
NF0795_high_55
[»] chr4 (1 HSPs)
chr4 (1-217)||(46040699-46040915)


Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 46040699 - 46040915
Alignment:
1 gagttcgatgaattagtagaagccataatgccgaacatgaatgcagaagtattggtgaatcaagaacaacttataggtgtgttcaagtgcttcgatcgcg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46040699 gagttcgatgaattagtagaagccataatgccgaacatgaatgcagaagtattggtgaatcaagaacaacttataggtgtgttcaagtgcttcgatcgcg 46040798  T
101 atgggaatggattcatttcagcagctgaattggctggagcaatggctaaaatgggtcagccacttacatacaaagagcttattgagatgattagagaggc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46040799 atgggaatggattcatttcagcagctgaattggctggagcaatggctaaaatgggtcagccacttacatacaaagagcttattgagatgattagagaggc 46040898  T
201 agatatggatggtgatg 217  Q
    |||||||||||||||||    
46040899 agatatggatggtgatg 46040915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 584 times since January 2019
Visitors: 5845