View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_high_58 (Length: 213)
Name: NF0795_high_58
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0795_high_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 17 - 97
Target Start/End: Original strand, 6729372 - 6729452
Alignment:
Q |
17 |
agtgagatgaagtgataacagtgtagagaaaggaataaaatttgttgaggtagagaatggggttgttgcagatccagtgaa |
97 |
Q |
|
|
|||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
6729372 |
agtgtgatgaagtgataacggtgtagagaaaagaataaaatttgttgaggtagagaatggggttgttgcagatctagtgaa |
6729452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 258 times since January 2019
Visitors: 5834