View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_low_13 (Length: 453)
Name: NF0795_low_13
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0795_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 54 - 107
Target Start/End: Complemental strand, 22552254 - 22552201
Alignment:
Q |
54 |
ggcgttggggttacgactgcgactgcagcgtttgttgcggtggttggaagggga |
107 |
Q |
|
|
|||||||||||||||||| |||| | |||||||||||||||||||||||||| |
|
|
T |
22552254 |
ggcgttggggttacgactacgacgacgacgtttgttgcggtggttggaagggga |
22552201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 228 - 256
Target Start/End: Complemental strand, 33962337 - 33962309
Alignment:
Q |
228 |
aaaaaatgggggagattgcagcatttgtt |
256 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
33962337 |
aaaaaatgggggagattgcagcatttgtt |
33962309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University