View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_low_20 (Length: 401)
Name: NF0795_low_20
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0795_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 6e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 135 - 321
Target Start/End: Original strand, 47838213 - 47838398
Alignment:
| Q |
135 |
ttaatatatacattgcatcttgattccagttttgattttttcacttatttattttaaaagatgaaattctaactgttaatatgttttataaaagataaag |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47838213 |
ttaatatatacattgcatcttgattccagttttgattttttcacttatttattttaaaagatgaaattctaacagttaatatgttttataaaagataaag |
47838312 |
T |
|
| Q |
235 |
agttgaattttataagctttaaaatgggaagagccagccaacccaacaatcttcaaaagtaaagcttaaaacaaattttgatgatgt |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47838313 |
agttgaattttataagctttaaaatgggaagagtcagccaaccc-ataatcttcaaaagtaaagcttaaaacaaattttgataatgt |
47838398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 147 times since January 2019
Visitors: 5832