View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0795_low_22 (Length: 398)

Name: NF0795_low_22
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0795_low_22
NF0795_low_22
[»] chr8 (2 HSPs)
chr8 (6-180)||(39725619-39725793)
chr8 (236-293)||(39725853-39725910)
[»] chr4 (1 HSPs)
chr4 (7-176)||(5624512-5624681)
[»] chr1 (1 HSPs)
chr1 (58-158)||(13348675-13348775)


Alignment Details
Target: chr8 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 6 - 180
Target Start/End: Original strand, 39725619 - 39725793
Alignment:
6 agcagcacagatgtttgtgttgagaacagccatggatgaatcaatgttggcagagtagggatctccaccgttgaaacctgcccatcccatccatagtaac 105  Q
    ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39725619 agcagcacaaatgtttgtgttgagaacagccattgatgaatcaatgttggcagagtagggatctccaccgttgaaacctgcccatcccatccatagtaac 39725718  T
106 cctgcccctgccaacgttagtaacacattgtttggtgggaatctctccctgtccttcttcgatcttggccccacc 180  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
39725719 cctgcccctgccaacgttagtaacacattgtttggtgggaatctctccctgtccttcttcgatctaggccccacc 39725793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 236 - 293
Target Start/End: Original strand, 39725853 - 39725910
Alignment:
236 tgtcaaaatataattacattatattgcaaacactaccaaacaatacatttctttcata 293  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39725853 tgtcaaaatataattacattatattgcaaacactaccaaacaatacatttctttcata 39725910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 7 - 176
Target Start/End: Original strand, 5624512 - 5624681
Alignment:
7 gcagcacagatgtttgtgttgagaacagccatggatgaatcaatgttggcagagtagggatctccaccgttgaaacctgcccatcccatccatagtaacc 106  Q
    |||||||| ||||| |||||||| ||||| || || || |||||||| || |  || ||  ||||||| ||||| |||| ||| ||||||||||  || |    
5624512 gcagcacatatgttagtgttgagtacagcaatagaagagtcaatgtttgctgcatatggtgctccaccattgaaccctgaccaacccatccataacaatc 5624611  T
107 ctgcccctgccaacgttagtaacacattgtttggtgggaatctctccctgtccttcttcgatcttggccc 176  Q
    |||| ||||| | | | || || |||||||||||||||||||||||||| ||  ||||| | ||||||||    
5624612 ctgctcctgctagcataagcaatacattgtttggtgggaatctctccctatcactcttcaaccttggccc 5624681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 58 - 158
Target Start/End: Original strand, 13348675 - 13348775
Alignment:
58 gagtagggatctccaccgttgaaacctgcccatcccatccatagtaaccctgcccctgccaacgttagtaacacattgtttggtgggaatctctccctgt 157  Q
    ||||| |||||||| || ||||| |||| |||||||||||||| ||  ||||| ||||| ||| | || |  | ||||||||||||||| || |||||||    
13348675 gagtaaggatctcctccattgaatcctgtccatcccatccataatagtcctgctcctgctaacataagaaggagattgtttggtgggaacctttccctgt 13348774  T
158 c 158  Q
    |    
13348775 c 13348775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 88 times since January 2019
Visitors: 5830