View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_low_23 (Length: 398)
Name: NF0795_low_23
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0795_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 15 - 369
Target Start/End: Complemental strand, 18367996 - 18367642
Alignment:
Q |
15 |
gactatctatcctcagcgccctggacagattgaatgtgatgtaagcacttgccttttgttccagtgatattattatacttcattgcccaatatctattat |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18367996 |
gactatctatcctcagcgccctggacagattgaatgtgatgtaagcacttgccttttgttccagtgatattattatacttcattgcccaatatctattat |
18367897 |
T |
 |
Q |
115 |
acttcacttgcctttgttgcttttattgctctgcttaggataatttagtattaggtgaaaaatgatgggggctaggggatctgtttcttgcttgacaatc |
214 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18367896 |
acttcacttgcctttgttgcttttattgctctgcttaggataatttagtattaggtgaaaaatgatgggggctaggggatctgtttcttgcttgacaatc |
18367797 |
T |
 |
Q |
215 |
tatctgtttattgaagactgctaacatactttaggctgccatgagctcattccattactgatcttaccccaaaaccttgtacttcttcccttatctattc |
314 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18367796 |
tatctgtttattgaagactgttaacatactttaggctgccatgagctcattccattactgatcttaccccaaaaccttgtacttcttcccttatctattc |
18367697 |
T |
 |
Q |
315 |
aagaaccgatctggtttaaaaatatttgattcttacaaaataaccctgttgttca |
369 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18367696 |
aagaaccgatctggtttaaaaatatttgattcttacaaaataaccctgttgttca |
18367642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University