View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_low_33 (Length: 367)
Name: NF0795_low_33
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0795_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 294
Target Start/End: Original strand, 52856706 - 52856999
Alignment:
| Q |
1 |
ctgcagaaaactgaattccctttggttcgtcacttgaattcacttgtggcgggatccttttgccaggacagcttccttccattattatttgatttttgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52856706 |
ctgcagaaaactgaattccctttggttcgtcacttgaattcacttgtggcgggatccttttgccaggacagcttccttccattattatttgatttttgct |
52856805 |
T |
 |
| Q |
101 |
gcttaaccgcatattgtgatgtaatttgctatccaaagatactgtaaatgataatgaccccgaattgcttgtggaaaactttgtcactagcacttggtct |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52856806 |
gcttaaccgcgtattgtgatgtaatttgctatccaaagatactgtaaatgataatgaccccgaattgcttgtggaaaactttgtcactagcacttggtct |
52856905 |
T |
 |
| Q |
201 |
ggattagaagcaaaatgctctctggtaaattcaacatatcacccacattatattttatttttgctgttgcattatccaaatcaagttctctgtg |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52856906 |
ggattagaagcaaaatgctctctggtaaattcaacatatcacccacattatattttatttttgctgttgcattatccaaatcaagttctctgtg |
52856999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 163; Significance: 5e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 48487515 - 48487794
Alignment:
| Q |
1 |
ctgcagaaaactgaattccctttggttcgtcacttgaattcacttgtggcgggatccttttgccaggacagcttccttccattattatttgatttttgct |
100 |
Q |
| |
|
||||| ||||||||||||| ||| |||| |||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||| ||||||| || |
|
|
| T |
48487515 |
ctgcacaaaactgaattcctttttgttcaccacttgaattcatttgtggcgcgatccttttgccaggacaacttccttccattattatctgattttggcc |
48487614 |
T |
 |
| Q |
101 |
gcttaaccgcatattgtgatgtaatttgctatccaaagatactgtaaatgataatgaccccgaattgcttgtggaaaactttgtcactagcacttggtct |
200 |
Q |
| |
|
||||| |||| |||||||||||| | |||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48487615 |
gcttacccgcgaattgtgatgtaactcgctatccaaagatactgtaaatgataatgaacccgacttgcttgtggaaaactttgtcgctagcacttggtcc |
48487714 |
T |
 |
| Q |
201 |
ggattagaagcaaaatgctctctggtaaattcaacatatcacccacattatattttatttttgctgttgcattatccaaatc |
282 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |||||||| ||||| || |||||||||||||| ||| |||||||||| |
|
|
| T |
48487715 |
ggtttagaagcaaaatgctctctggtaaattc--tatatcacctacattgtactttatttttgctgtagcactatccaaatc |
48487794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University