View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_low_55 (Length: 306)
Name: NF0795_low_55
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0795_low_55 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 173 - 222
Target Start/End: Complemental strand, 3414097 - 3414048
Alignment:
| Q |
173 |
gtagatcaaatactttgaaaacaagctagagggctccaatatgaaaaaac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
3414097 |
gtagatcaaatactttgaaaacaagctagatggttccaatatgaaaaaac |
3414048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 65 - 99
Target Start/End: Complemental strand, 3414205 - 3414171
Alignment:
| Q |
65 |
agatgaactagaaaaataagagatatcaccatgat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3414205 |
agatgaactagaaaaataagagatatcaccatgat |
3414171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 328 times since January 2019
Visitors: 5835