View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_low_57 (Length: 304)
Name: NF0795_low_57
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0795_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 12 - 222
Target Start/End: Original strand, 46223822 - 46224028
Alignment:
| Q |
12 |
gacggccagtggtagttagtttgataaccgtacatcagctgtacggtgcagcaactgtgacagtcgttagatagggagaaaatttctctgcatttggcta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46223822 |
gacggccagtggtagttagtttgataaccgtacatcagctgtacggtgcagcaactgtgacagtcgttagatagggagaaaatttctctgcatttggcta |
46223921 |
T |
 |
| Q |
112 |
tagagaatccaaatcctcccacatttgggaaagttgtcttctcaccaagataatttatgtgtagcggggtgcaccgtaaaattagttgcacaagattaaa |
211 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46223922 |
tagagaatccaaa---tcccacatttgggaaagttgtcttctcgccaagat-atttatgtgtagcgggttgcaccgtaaaattagttgcacaagattaaa |
46224017 |
T |
 |
| Q |
212 |
gtttgtgttct |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
46224018 |
gtttgtgttct |
46224028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University