View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_low_61 (Length: 300)
Name: NF0795_low_61
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0795_low_61 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 16 - 267
Target Start/End: Original strand, 8653355 - 8653606
Alignment:
Q |
16 |
taataacatgtgcatgcaagtaattagtgtttggagagacttgccttggagagatggcaacagctgcaatggcagaagaagcacaagcagaagccatgat |
115 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8653355 |
taataacatgtgcatgcaagtaattagtgtttgtagagacttgccttggagagatggcaacagctgcaatggcagaagaagcacaagcagaagccatgat |
8653454 |
T |
 |
Q |
116 |
actgttcttgccctcaagggataaaagtgagtaagttttgtgagttttggttatgagaatgattggttggtgaatatgaaagaaaatatgctaattttgt |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8653455 |
actgttcttgccctcaagggataaaagtgagtaagttttgtgagttttggttatgagaatgattggttggtgaatatgaaagaaaatatgctaattttgt |
8653554 |
T |
 |
Q |
216 |
taatgtatgcaatgtttcttatccttaaggataggagtgtgaatttgatact |
267 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
8653555 |
taatgtatgcaatgtttcttatccttaaggataggtgtgtgaatttgatact |
8653606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1104 times since January 2019
Visitors: 5825