View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_low_67 (Length: 279)
Name: NF0795_low_67
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0795_low_67 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 49 - 254
Target Start/End: Complemental strand, 31192831 - 31192623
Alignment:
| Q |
49 |
cagaaaatatacgcaaacttcaagtacg---tccctgcacatcaaatgcctataacattgatataaacctcattgcagaaactatttcttaaaaaccata |
145 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31192831 |
cagaaaatttacgcaaacttcaagtgcggcgtccctgcacatcaaatgcctataacattgatataaacctcattgcagaaactatttcttaaaaaccata |
31192732 |
T |
|
| Q |
146 |
tagcacagtggatataatgttattttctggaaggatattgcatagtccctacaaaagataattcaagcacagaaatttgaccctcttttgctcttttgtt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31192731 |
tagcacagtggatataatgttattttctggaaggatattgcatagtccctacaaaagataattcaagcacagaaatttgaccctcttttgctcttttgtt |
31192632 |
T |
|
| Q |
246 |
gtgcctatg |
254 |
Q |
| |
|
||||||||| |
|
|
| T |
31192631 |
gtgcctatg |
31192623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 49 - 254
Target Start/End: Complemental strand, 31014574 - 31014370
Alignment:
| Q |
49 |
cagaaaatatacgcaaacttcaagtacgtccctgcacatcaaatgcctataacattgatataaacctcattgcagaaactatttcttaaaaaccatatag |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| || |||||| |
|
|
| T |
31014574 |
cagaaaatatacgcaaacttcaagtacgtccctgcacatcaaatgcctataacattgatataaactacactgcagaaactatttcttaaatac-atatag |
31014476 |
T |
|
| Q |
149 |
cacagtggatataatgttattttctggaaggatattgcatagtccctacaaaagataattcaagcacagaaatttgaccctcttttgctcttttgttgtg |
248 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31014475 |
cacagtggatataatgttattttcttgaaggatatgtcatagtccctacaaaagataattcaagcacagaaatttgaccctcttttgctcttttgttgtg |
31014376 |
T |
|
| Q |
249 |
cctatg |
254 |
Q |
| |
|
|||||| |
|
|
| T |
31014375 |
cctatg |
31014370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1187 times since January 2019
Visitors: 5828