View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_low_71 (Length: 263)
Name: NF0795_low_71
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0795_low_71 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 515773 - 515938
Alignment:
| Q |
1 |
cctccgtcagctgaaaattgtaatggagttttcatttcgtatgattttcttgatcggaggaagggatttcctcgggtcaagaatgtcacggcacaatctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
515773 |
cctccgtcagctgaaaattgtaatggagttttcatttcgtatgattttcttgatcggaggaagggatttcctcgggtcaagaatgtcacggcacaatctt |
515872 |
T |
|
| Q |
101 |
ggtcctttaatgcaaccgcaacagttctcaacacaggaaaagatgtacttaaagcatggaaattgt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
515873 |
ggtcctttaatgcaaccgcaacagttctcaacacaggaaaagatgtacttaaagcatggaaattgt |
515938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 133 times since January 2019
Visitors: 5831