View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_low_84 (Length: 234)
Name: NF0795_low_84
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0795_low_84 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 46040699 - 46040915
Alignment:
Q |
1 |
gagttcgatgaattagtagaagccataatgccgaacatgaatgcagaagtattggtgaatcaagaacaacttataggtgtgttcaagtgcttcgatcgcg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46040699 |
gagttcgatgaattagtagaagccataatgccgaacatgaatgcagaagtattggtgaatcaagaacaacttataggtgtgttcaagtgcttcgatcgcg |
46040798 |
T |
 |
Q |
101 |
atgggaatggattcatttcagcagctgaattggctggagcaatggctaaaatgggtcagccacttacatacaaagagcttattgagatgattagagaggc |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46040799 |
atgggaatggattcatttcagcagctgaattggctggagcaatggctaaaatgggtcagccacttacatacaaagagcttattgagatgattagagaggc |
46040898 |
T |
 |
Q |
201 |
agatatggatggtgatg |
217 |
Q |
|
|
||||||||||||||||| |
|
|
T |
46040899 |
agatatggatggtgatg |
46040915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 300 times since January 2019
Visitors: 5834