View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_low_85 (Length: 225)
Name: NF0795_low_85
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0795_low_85 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 21 - 145
Target Start/End: Original strand, 25695549 - 25695674
Alignment:
| Q |
21 |
acatcatcataataataacctcaatctcaacttt-cacagcatttttcacacacgtggtctccaccatcatgtgaaatgagtgtccttatgtttctaaat |
119 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25695549 |
acatcatcatcataataacctcaatctcaacttttcacagcatttttcacacacgtggtctccaccatcatgtgaaatgagtgtccttatgtttctaaat |
25695648 |
T |
|
| Q |
120 |
catgactctaccaccacttcatctca |
145 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
25695649 |
catgactctaccaccacttcttctca |
25695674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 40 times since January 2019
Visitors: 5829