View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_low_86 (Length: 222)
Name: NF0795_low_86
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0795_low_86 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 37240572 - 37240377
Alignment:
Q |
1 |
taaattgggaccccccacccnnnnnnnnnttaacatttctttttgccttactttttcttagatttgatctttcatgtcatttttatnnnnnnnnnnnnnn |
100 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37240572 |
taaattgggaccccccacccaaagaaaaattaacatttctttttgccttactttttcttagatttgatctttcatgtcatttttataaataaaaaaaaaa |
37240473 |
T |
 |
Q |
101 |
nnn---tgcattcaaacccaagttttgctacagaataaaataagaaattgtacatagaaacaccaagaaaaatatctcaaaacccccatgttacct |
193 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37240472 |
aaaaaatgtattcaaacccaagttttgctacagaataaaataagaaattgtacatagaaacaccaagaaaaatatctcaaaacccccatgttacct |
37240377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University