View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0795_low_86 (Length: 222)

Name: NF0795_low_86
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0795_low_86
NF0795_low_86
[»] chr1 (1 HSPs)
chr1 (1-193)||(37240377-37240572)


Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 37240572 - 37240377
Alignment:
1 taaattgggaccccccacccnnnnnnnnnttaacatttctttttgccttactttttcttagatttgatctttcatgtcatttttatnnnnnnnnnnnnnn 100  Q
    ||||||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||                  
37240572 taaattgggaccccccacccaaagaaaaattaacatttctttttgccttactttttcttagatttgatctttcatgtcatttttataaataaaaaaaaaa 37240473  T
101 nnn---tgcattcaaacccaagttttgctacagaataaaataagaaattgtacatagaaacaccaagaaaaatatctcaaaacccccatgttacct 193  Q
          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37240472 aaaaaatgtattcaaacccaagttttgctacagaataaaataagaaattgtacatagaaacaccaagaaaaatatctcaaaacccccatgttacct 37240377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University