View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0795_low_91 (Length: 206)
Name: NF0795_low_91
Description: NF0795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0795_low_91 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 50 - 188
Target Start/End: Original strand, 32217551 - 32217689
Alignment:
Q |
50 |
ttcaaattattagcaccaaaaaccaaaaacttgtgcaagaagcatcacatattatatcataccttccctaaaatgggatactcagccttatatctgtcac |
149 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32217551 |
ttcaaattattagcaccaaaaaccaaaaacttgtgcaagaagcatcacatattatatcataccttccctaaaatgggatactcagccttatatctgtcac |
32217650 |
T |
 |
Q |
150 |
aggcaaaatcttgtgcctcctgactagtccctggttctt |
188 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32217651 |
aggcaaaatcttgtgcctcctgactagtccctggttctt |
32217689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 165 times since January 2019
Visitors: 5832