View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796-Insertion-11 (Length: 208)
Name: NF0796-Insertion-11
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0796-Insertion-11 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 208
Target Start/End: Original strand, 24819860 - 24820060
Alignment:
Q |
8 |
ttaattaactctttggttaagcttattaggttaagctttagtttaaccctaatcataatcttggaaccatcgattaggttttgtgagttttggttatctg |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
T |
24819860 |
ttaattaactctttggttaagcttattaggttaagctttagtttaaccctaatcataatcttggaatcatcaattaggttttgtgagttttggttatctg |
24819959 |
T |
 |
Q |
108 |
tctctttttatgtttcaagcagtttttagataatttttgaagtgtttagagcataggttctgtcagattctacgtgatgctagattatactttcaacatg |
207 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24819960 |
tctctttttatgtttcaagcagattttagataatttttgaagtgtttagagcaaaggttctgtcagattctacgtgatgctagattatactttcaacatg |
24820059 |
T |
 |
Q |
208 |
a |
208 |
Q |
|
|
| |
|
|
T |
24820060 |
a |
24820060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 106 - 205
Target Start/End: Complemental strand, 37686377 - 37686278
Alignment:
Q |
106 |
tgtctctttttatgtttcaagcagtttttagataatttttgaagtgtttagagcataggttctgtcagattctacgtgatgctagattatactttcaaca |
205 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||| |||||||||||| ||||||||||| |
|
|
T |
37686377 |
tgtctctttttatgtttcaagcagtttttagatgatttttgaagtgtttagagcaaaggttttgtcagattctacatgatgctagattttactttcaaca |
37686278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 26 - 65
Target Start/End: Original strand, 46330250 - 46330289
Alignment:
Q |
26 |
aagcttattaggttaagctttagtttaaccctaatcataa |
65 |
Q |
|
|
||||||||||||||||||||| | |||||||||||||||| |
|
|
T |
46330250 |
aagcttattaggttaagcttttgcttaaccctaatcataa |
46330289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 106 - 205
Target Start/End: Original strand, 7497364 - 7497460
Alignment:
Q |
106 |
tgtctctttttatgtttcaagcagtttttagataatttttgaagtgtttagagcataggttctgtcagattctacgtgatgctagattatactttcaaca |
205 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||| |||||||||||||||||| | ||||||||||| |
|
|
T |
7497364 |
tgtctctttttatgtttcaagcagtttttagacgatttttgaagtgtttagagcaaaggttttgt---attctacgtgatgctagactttactttcaaca |
7497460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University