View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796-Insertion-17 (Length: 74)
Name: NF0796-Insertion-17
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0796-Insertion-17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 48; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 4e-19
Query Start/End: Original strand, 12 - 59
Target Start/End: Complemental strand, 43760176 - 43760129
Alignment:
| Q |
12 |
aaacacgagcggcgcgacccgagaaacaagaacaagctaggctactac |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43760176 |
aaacacgagcggcgcgacccgagaaacaagaacaagctaggctactac |
43760129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University