View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796-Insertion-18 (Length: 63)
Name: NF0796-Insertion-18
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0796-Insertion-18 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 53; Significance: 3e-22; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 7 - 63
Target Start/End: Original strand, 3091981 - 3092037
Alignment:
| Q |
7 |
acaatctttgaccataatggtaatagacacactgcagctgatcttttggaatatgct |
63 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3091981 |
acaatctttgaccataatggtcatagacacactgcagctgatcttttggaatatgct |
3092037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 8e-20
Query Start/End: Original strand, 7 - 63
Target Start/End: Original strand, 3083541 - 3083597
Alignment:
| Q |
7 |
acaatctttgaccataatggtaatagacacactgcagctgatcttttggaatatgct |
63 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3083541 |
acaatctttgaccataatggtcatagacacactgctgctgatcttttggaatatgct |
3083597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University