View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796-Insertion-4 (Length: 741)
Name: NF0796-Insertion-4
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0796-Insertion-4 |
 |  |
|
[»] chr2 (4 HSPs) |
 |  |
|
[»] chr7 (6 HSPs) |
 |  |
|
[»] chr8 (5 HSPs) |
 |  |
|
[»] chr1 (9 HSPs) |
 |  |
|
[»] chr5 (4 HSPs) |
 |  |
|
[»] chr4 (4 HSPs) |
 |  |
|
[»] scaffold0168 (1 HSPs) |
 |  |
|
[»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 648; Significance: 0; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 648; E-Value: 0
Query Start/End: Original strand, 8 - 741
Target Start/End: Complemental strand, 37066204 - 37065473
Alignment:
Q |
8 |
ctatcatcgcctcgttgagcccgccaccgttccggcaagtcacctgagagagatttccaaagggcatgtactccatgaagaggttgaacaagtgcttgtt |
107 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37066204 |
ctatcatcgcctcgttgagccggccaccgttccggcaagtcacctgagagagatttccaaagggcatgtactccatgaagaggttgaacaagtgcttgtt |
37066105 |
T |
 |
Q |
108 |
attctcctttgaaaagttacaacctttgtaggtaactatgtaaggagaggacagagaagaaagaattctttgttctctctggagttggtttgagtttggt |
207 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
37066104 |
attctcctttgaaaagttgcaacctttgtaggtaactatgtaaggagaggacagagaagaaagaattctttgttcactctggagttggtttgagtttggt |
37066005 |
T |
 |
Q |
208 |
agtgatgtctccgttgatttaaccgcggagacatcggtggagcgacgagaggtggcgaggtagacggtggcggatgagccatgtccgatgatgttgcctc |
307 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37066004 |
agtgatgtctccgctgatttaaccgcggagacatcggtggagcgacgagaggtggcgaggtagacggtggcggatgagccatgtccgatgatgttgcctc |
37065905 |
T |
 |
Q |
308 |
tagtccactccatctccatattttgtgtttaaggctatagtttgatattgcggcctttatataatagttgaaaaaataggcacactttgaatatgagttt |
407 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37065904 |
tagtccactccatctccatattttgtgtttaaggctatggtttgatattgcggcctttatataatagttgaaaaaataggcacactttgaatatgagttt |
37065805 |
T |
 |
Q |
408 |
taaaaggattaattttattggttggtttacttaattagttgaagctattttccctttagaggggagtgagtgttacttcaaaggggagtttaggacgtgt |
507 |
Q |
|
|
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37065804 |
tta---gattaattttattggttggtttacttaattagttgaagctattttccctttagaggggagtgagtgttacttcaaaggggagtttaggacgtgt |
37065708 |
T |
 |
Q |
508 |
tcaaatttgggtggttgtggcagcttagttggcaatttattattatatggcacgtggaaaatttaacctagaagttttttgtatagtgtgtgaattatta |
607 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37065707 |
tcaaatttgggtggttgtggcagcttagttggcaatttattattatatggcacgtggaaaatttaacctagaagttttttgtatagtgtgtgaattatta |
37065608 |
T |
 |
Q |
608 |
catccatctagataccattttaagttgatataaacgaaactagacttctatctctt-nnnnnnntgtgattgggtcccgtgatcatagctcagttggtat |
706 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |||||||| |
|
|
T |
37065607 |
catccatctagataccaatttaagttgatataaacgaaactagacttctatctcttaaaaaaaatgtgattgggtcccgtgagcatagctctgttggtat |
37065508 |
T |
 |
Q |
707 |
agacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||| |||||||||||||||||||||||||||| |
|
|
T |
37065507 |
ggacatgcattgttatatgcagtggtcggggttcg |
37065473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 691 - 741
Target Start/End: Complemental strand, 44132652 - 44132602
Alignment:
Q |
691 |
atagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||||||||||| | |||||| ||||||||||||||| |||||||||||| |
|
|
T |
44132652 |
atagctcagttggcagagacatgcattgttatatgcagaggtcggggttcg |
44132602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 682 - 741
Target Start/End: Original strand, 11133072 - 11133132
Alignment:
Q |
682 |
cccgtgatcatagctcagttggtatagaca-tacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||||| |||||||||||||||| |||| | ||||||||||||||| |||||||||||| |
|
|
T |
11133072 |
cccgtgagcatagctcagttggtagggacaatgcattgttatatgcaggggtcggggttcg |
11133132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 683 - 741
Target Start/End: Complemental strand, 14307791 - 14307733
Alignment:
Q |
683 |
ccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
|||||| ||| |||||||||||| ||||| ||||||||||||||| ||||| |||||| |
|
|
T |
14307791 |
ccgtgagcatggctcagttggtagggacatgcattgttatatgcaggggtcgaggttcg |
14307733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 684 - 741
Target Start/End: Complemental strand, 10474608 - 10474551
Alignment:
Q |
684 |
cgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||| ||||| |||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
T |
10474608 |
cgtgagcatagttcagttggtagagacatacattgttatatgcaggggtcggggttcg |
10474551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 681 - 741
Target Start/End: Original strand, 7465462 - 7465522
Alignment:
Q |
681 |
tcccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
|||||||| |||||||||||||| | |||||| |||| |||||||||| || ||||||||| |
|
|
T |
7465462 |
tcccgtgagcatagctcagttggcagagacatgcattattatatgcaggggccggggttcg |
7465522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 681 - 741
Target Start/End: Original strand, 11808034 - 11808094
Alignment:
Q |
681 |
tcccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
|||||||| | ||||||| |||||| ||||| ||||||||||||||| |||||||||||| |
|
|
T |
11808034 |
tcccgtgagcttagctcaattggtagggacatgcattgttatatgcaggggtcggggttcg |
11808094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 682 - 741
Target Start/End: Original strand, 43635585 - 43635644
Alignment:
Q |
682 |
cccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||||| |||| ||||||||| | | |||| ||||||||||||||| |||||||||||| |
|
|
T |
43635585 |
cccgtgagcataactcagttggcagaaacatgcattgttatatgcagcggtcggggttcg |
43635644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 683 - 741
Target Start/End: Original strand, 32814825 - 32814883
Alignment:
Q |
683 |
ccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
|||||| |||||||||||||||| ||||| |||| |||||||||| |||||| ||||| |
|
|
T |
32814825 |
ccgtgagcatagctcagttggtagggacatgcattattatatgcaggggtcggagttcg |
32814883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 683 - 733
Target Start/End: Complemental strand, 37410578 - 37410528
Alignment:
Q |
683 |
ccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtc |
733 |
Q |
|
|
|||||| |||||||||||||||| ||||| ||||||||||||||| |||| |
|
|
T |
37410578 |
ccgtgagcatagctcagttggtaaggacatgcattgttatatgcaggggtc |
37410528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.00000000002; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 681 - 741
Target Start/End: Complemental strand, 216246 - 216186
Alignment:
Q |
681 |
tcccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
|||||||| |||||||||||||| | ||||||||||||||||||||| |||| ||||||| |
|
|
T |
216246 |
tcccgtgagcatagctcagttggcagggacatacattgttatatgcagaggtcagggttcg |
216186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 681 - 741
Target Start/End: Complemental strand, 692806 - 692746
Alignment:
Q |
681 |
tcccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
|||||||| |||||||||||||| | ||||||||||||||||||||| |||| ||||||| |
|
|
T |
692806 |
tcccgtgagcatagctcagttggcagggacatacattgttatatgcagaggtcagggttcg |
692746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 681 - 741
Target Start/End: Complemental strand, 697015 - 696955
Alignment:
Q |
681 |
tcccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
|||||||| |||||||||||||| | ||||||||||||||||||||| |||| ||||||| |
|
|
T |
697015 |
tcccgtgagcatagctcagttggcagggacatacattgttatatgcagaggtcagggttcg |
696955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 681 - 741
Target Start/End: Complemental strand, 729869 - 729809
Alignment:
Q |
681 |
tcccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
|||||||| |||||||||||||| | ||||||||||||||||||||| |||| ||||||| |
|
|
T |
729869 |
tcccgtgagcatagctcagttggcagggacatacattgttatatgcagaggtcagggttcg |
729809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 681 - 741
Target Start/End: Complemental strand, 853764 - 853704
Alignment:
Q |
681 |
tcccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
|||||||| |||||||||||||| | ||||||||||||||||||||| |||| ||||||| |
|
|
T |
853764 |
tcccgtgagcatagctcagttggcagggacatacattgttatatgcagaggtcagggttcg |
853704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.00000000002; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 681 - 741
Target Start/End: Complemental strand, 47645895 - 47645835
Alignment:
Q |
681 |
tcccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
|||| ||| |||||||||||||| | |||||| ||||||||||||||| |||||||||||| |
|
|
T |
47645895 |
tcccatgagcatagctcagttggcagagacatgcattgttatatgcagaggtcggggttcg |
47645835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 682 - 741
Target Start/End: Complemental strand, 9768907 - 9768848
Alignment:
Q |
682 |
cccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||||| |||||||||||||| | ||||| ||||||||||||||| |||||||||||| |
|
|
T |
9768907 |
cccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcggggttcg |
9768848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 682 - 741
Target Start/End: Original strand, 18003813 - 18003872
Alignment:
Q |
682 |
cccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||||| |||||||||||||| | ||||| ||||||||||||||| || ||||||||| |
|
|
T |
18003813 |
cccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttcg |
18003872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 682 - 741
Target Start/End: Original strand, 42801876 - 42801935
Alignment:
Q |
682 |
cccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||||| ||||||||||||| | |||||| ||||||||||||||| ||| |||||||| |
|
|
T |
42801876 |
cccgtgaacatagctcagttgacagagacatgcattgttatatgcagaggttggggttcg |
42801935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 682 - 741
Target Start/End: Original strand, 42908768 - 42908827
Alignment:
Q |
682 |
cccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||||| | |||||||||||| | ||||| ||||||||||||||| |||||||||||| |
|
|
T |
42908768 |
cccgtgagcttagctcagttggcagggacatgcattgttatatgcaggggtcggggttcg |
42908827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 682 - 741
Target Start/End: Complemental strand, 52961180 - 52961121
Alignment:
Q |
682 |
cccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||||| |||||||||||||| | ||||| ||||||||||||||| || ||||||||| |
|
|
T |
52961180 |
cccgtgagcatagctcagttggcaaggacatgcattgttatatgcaggggccggggttcg |
52961121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 682 - 728
Target Start/End: Complemental strand, 51917600 - 51917554
Alignment:
Q |
682 |
cccgtgatcatagctcagttggtatagacatacattgttatatgcag |
728 |
Q |
|
|
||||||| |||||||||||||| |||||||| |||| |||||||||| |
|
|
T |
51917600 |
cccgtgagcatagctcagttggcatagacatgcattattatatgcag |
51917554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 684 - 741
Target Start/End: Original strand, 5862127 - 5862184
Alignment:
Q |
684 |
cgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||| |||||||||||||| | ||||| |||||||||||| || |||||||||||| |
|
|
T |
5862127 |
cgtgaacatagctcagttggcagggacatgcattgttatatgtagaggtcggggttcg |
5862184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 684 - 741
Target Start/End: Complemental strand, 11238124 - 11238067
Alignment:
Q |
684 |
cgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||| |||||||||| ||| || ||||| |||| |||||||||| |||||||||||| |
|
|
T |
11238124 |
cgtgagcatagctcagatggcatggacatgcattattatatgcaggggtcggggttcg |
11238067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000007; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 682 - 741
Target Start/End: Complemental strand, 7147117 - 7147058
Alignment:
Q |
682 |
cccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||||| |||||||||||||||| ||||| |||| |||||||||| |||||||||||| |
|
|
T |
7147117 |
cccgtgagcatagctcagttggtaaggacatgcattattatatgcaggggtcggggttcg |
7147058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 680 - 741
Target Start/End: Complemental strand, 42801541 - 42801480
Alignment:
Q |
680 |
gtcccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||||||||||||||||||||||||| || |||| |||||||||| |||||||||||| |
|
|
T |
42801541 |
gtcccgtgatcatagctcagttggtatgataatgcattattatatgcaggggtcggggttcg |
42801480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 681 - 741
Target Start/End: Complemental strand, 36742066 - 36742006
Alignment:
Q |
681 |
tcccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
|||||||| |||||||||||||| | |||||| |||||||||||||| | |||||||||| |
|
|
T |
36742066 |
tcccgtgagcatagctcagttggcagagacatgaattgttatatgcagggatcggggttcg |
36742006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 683 - 737
Target Start/End: Complemental strand, 11246591 - 11246537
Alignment:
Q |
683 |
ccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcgggg |
737 |
Q |
|
|
|||||| |||||||||||||| | ||||| ||||||||||||||| |||||||| |
|
|
T |
11246591 |
ccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcgggg |
11246537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000004; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 681 - 741
Target Start/End: Original strand, 27921892 - 27921952
Alignment:
Q |
681 |
tcccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
|||||||| |||||||||||||||| ||||| |||| |||||||||| || ||||||||| |
|
|
T |
27921892 |
tcccgtgagcatagctcagttggtagggacatgcattattatatgcaggggccggggttcg |
27921952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 684 - 740
Target Start/End: Original strand, 49319392 - 49319448
Alignment:
Q |
684 |
cgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttc |
740 |
Q |
|
|
||||| |||||||||||||| || ||||| |||| |||||||||| ||||||||||| |
|
|
T |
49319392 |
cgtgagcatagctcagttggcatggacatgcattattatatgcaggggtcggggttc |
49319448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 685 - 741
Target Start/End: Complemental strand, 52556770 - 52556714
Alignment:
Q |
685 |
gtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
|||| ||||||||||||| || |||||||||||||||||||| |||||||||||| |
|
|
T |
52556770 |
gtgaacatagctcagttgataggaacatacattgttatatgcaggggtcggggttcg |
52556714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 682 - 739
Target Start/End: Complemental strand, 12820504 - 12820446
Alignment:
Q |
682 |
cccgtgatcatagctcagttggtatagaca-tacattgttatatgcagtggtcggggtt |
739 |
Q |
|
|
||||||| |||||||||||||| | ||||| | ||||||||||||||| |||||||||| |
|
|
T |
12820504 |
cccgtgagcatagctcagttggcagagacaatgcattgttatatgcaggggtcggggtt |
12820446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 682 - 741
Target Start/End: Complemental strand, 34131 - 34072
Alignment:
Q |
682 |
cccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||||| |||||||||||||| | ||||| ||||||||||||||| || ||||||||| |
|
|
T |
34131 |
cccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttcg |
34072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.00000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 682 - 741
Target Start/End: Complemental strand, 25064767 - 25064708
Alignment:
Q |
682 |
cccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||||| ||||| ||||||||||| ||||| |||| |||||||||| ||| |||||||| |
|
|
T |
25064767 |
cccgtgagcatagttcagttggtatggacatgcattattatatgcaggggttggggttcg |
25064708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 682 - 741
Target Start/End: Original strand, 34524872 - 34524931
Alignment:
Q |
682 |
cccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||||| |||||||||||||| | ||||| ||||||||||||||| || ||||||||| |
|
|
T |
34524872 |
cccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttcg |
34524931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.00000002; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 681 - 728
Target Start/End: Original strand, 2903704 - 2903751
Alignment:
Q |
681 |
tcccgtgatcatagctcagttggtatagacatacattgttatatgcag |
728 |
Q |
|
|
|||||||| ||||||| |||||| || ||||||||||||||||||||| |
|
|
T |
2903704 |
tcccgtgaacatagcttagttggcatggacatacattgttatatgcag |
2903751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 683 - 728
Target Start/End: Original strand, 3973300 - 3973345
Alignment:
Q |
683 |
ccgtgatcatagctcagttggtatagacatacattgttatatgcag |
728 |
Q |
|
|
|||||| |||||||||||||||| ||||| ||||||||||||||| |
|
|
T |
3973300 |
ccgtgagcatagctcagttggtagggacatgcattgttatatgcag |
3973345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 683 - 728
Target Start/End: Complemental strand, 3996576 - 3996531
Alignment:
Q |
683 |
ccgtgatcatagctcagttggtatagacatacattgttatatgcag |
728 |
Q |
|
|
|||||| |||||||||||||||| ||||| ||||||||||||||| |
|
|
T |
3996576 |
ccgtgagcatagctcagttggtagggacatgcattgttatatgcag |
3996531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 682 - 739
Target Start/End: Original strand, 24130556 - 24130613
Alignment:
Q |
682 |
cccgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggtt |
739 |
Q |
|
|
||||||| |||| ||||||||| | ||||||||||||||||||||| || ||||||| |
|
|
T |
24130556 |
cccgtgagcataactcagttggcagggacatacattgttatatgcaggggacggggtt |
24130613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 684 - 741
Target Start/End: Complemental strand, 24160624 - 24160567
Alignment:
Q |
684 |
cgtgatcatagctcagttggtatagacatacattgttatatgcagtggtcggggttcg |
741 |
Q |
|
|
||||| |||| ||||||||| | |||||| || |||||||||||| |||||||||||| |
|
|
T |
24160624 |
cgtgagcataactcagttggcagagacatgcactgttatatgcaggggtcggggttcg |
24160567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4640 times since January 2019
Visitors: 5751