View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0796-Insertion-5 (Length: 509)
Name: NF0796-Insertion-5
Description: NF0796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0796-Insertion-5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 3e-46; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 73 - 295
Target Start/End: Complemental strand, 2339331 - 2339109
Alignment:
| Q |
73 |
aactacactcatcgctggggtcttgggaacggacttagatctccgttttgcagctaggcgttcctgttgttgcctttgtgtagaattattagcattggaa |
172 |
Q |
| |
|
|||| ||||||| | |||||||||||||| ||| ||||||| |||||||||||||||| || |||||||||||||||| ||||||| ||||||| | || |
|
|
| T |
2339331 |
aactccactcattgatggggtcttgggaaaggaattagatccccgttttgcagctaggtgtgcctgttgttgcctttgagtagaatcattagcaatataa |
2339232 |
T |
|
| Q |
173 |
gtcaaagatggagttccaacagctgcggcatgagaagccattggtgccttctccttttgtaatgctccaggtgtaattttcattgaagaccgtctaaaat |
272 |
Q |
| |
|
||||||||||||||||||||||| || | | | |||||||||| ||||||||| |||||||||||||| | || | | |||| |||||| ||| |||| |
|
|
| T |
2339231 |
gtcaaagatggagttccaacagcagcagtacgtgaagccattgctgccttctctttttgtaatgctcctgatgcattgttcactgaagatggtccaaaac |
2339132 |
T |
|
| Q |
273 |
ttggtccagctgaaccatcagaa |
295 |
Q |
| |
|
|||||||| ||||||||| |||| |
|
|
| T |
2339131 |
ttggtccaactgaaccattagaa |
2339109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 21 - 74
Target Start/End: Complemental strand, 2338813 - 2338760
Alignment:
| Q |
21 |
cccctgactgttgatttaaccccccttcaaaaacctgctggggaaatttctgaa |
74 |
Q |
| |
|
|||||| || ||||||||| ||||| |||||||||||||||||||| ||||||| |
|
|
| T |
2338813 |
cccctgtctcttgatttaaacccccatcaaaaacctgctggggaaacttctgaa |
2338760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 470 - 509
Target Start/End: Complemental strand, 2338944 - 2338905
Alignment:
| Q |
470 |
taaatttcttgcatacatttccacctcacttttaatgcgg |
509 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
2338944 |
taaatttcttgcatacatttcgaactcacttttaatgcgg |
2338905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 87; Significance: 2e-41; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 340 - 503
Target Start/End: Complemental strand, 7749158 - 7748993
Alignment:
| Q |
340 |
ctgaagatgatcctccttttttgcttctttcatgatttgctggcccagacaatttgaggttgtctg--ggaaattaggtctcatcaatgcatgctgtagc |
437 |
Q |
| |
|
|||||| |||||||||||||| ||||||||| ||||||||||||||||| ||| |||||||||| ||||||||| |||||| |||||||| ||| || |
|
|
| T |
7749158 |
ctgaagctgatcctcctttttggcttctttctcgatttgctggcccagactattccaggttgtctgtgggaaattagatctcatgaatgcatgttgtggc |
7749059 |
T |
|
| Q |
438 |
attctttgttgaatccgcaattgttgtgggtctaaatttcttgcatacatttccacctcactttta |
503 |
Q |
| |
|
|||||||| |||| ||| |||||||||||||||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
7749058 |
attctttgctgaagccgtaattgttgtgggtctaaattgcttgcatccatttccaactcactttta |
7748993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 7 - 66
Target Start/End: Complemental strand, 44915193 - 44915134
Alignment:
| Q |
7 |
agcaaattgagtgccccctgactgttgatttaaccccccttcaaaaacctgctggggaaa |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44915193 |
agcaaattgagtgccccctgactgttgatttaaccccccttcaaaaacctgctgtggaaa |
44915134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 73 - 158
Target Start/End: Complemental strand, 7749446 - 7749361
Alignment:
| Q |
73 |
aactacactcatcgctggggtcttgggaacggacttagatctccgttttgcagctaggcgttcctgttgttgcctttgtgtagaat |
158 |
Q |
| |
|
|||| ||||||| || || |||||||||| ||| |||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
7749446 |
aactccactcattgcaggtgtcttgggaagggaattagatctccgttttgcagctaggtgtgcctgttgttgcctttgtgtagaat |
7749361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 404 - 475
Target Start/End: Complemental strand, 44915346 - 44915275
Alignment:
| Q |
404 |
tgggaaattaggtctcatcaatgcatgctgtagcattctttgttgaatccgcaattgttgtgggtctaaatt |
475 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| |||||||||||||| ||| | |||||||||||||||||| |
|
|
| T |
44915346 |
tgggaaattaggtctcatggatgcatgttgtgccattctttgttgaagccgtacttgttgtgggtctaaatt |
44915275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 31 - 75
Target Start/End: Complemental strand, 7748885 - 7748841
Alignment:
| Q |
31 |
ttgatttaaccccccttcaaaaacctgctggggaaatttctgaac |
75 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
7748885 |
ttgatttaaccccccttcaaaaccctgctggggaaacttctgaac |
7748841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 73 - 151
Target Start/End: Complemental strand, 44915663 - 44915584
Alignment:
| Q |
73 |
aactacactcatcgctggggtcttgggaacggacttagatc-tccgttttgcagctaggcgttcctgttgttgcctttgt |
151 |
Q |
| |
|
|||| ||||||| | |||||||||||||| ||| |||||| ||| ||||||||||||| || |||||||||||||||| |
|
|
| T |
44915663 |
aactccactcattgttggggtcttgggaagggaattagattatccattttgcagctaggtgtgtctgttgttgcctttgt |
44915584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 179 - 288
Target Start/End: Complemental strand, 7749355 - 7749246
Alignment:
| Q |
179 |
gatggagttccaacagctgcggcatgagaagccattggtgccttctccttttgtaatgctccaggtgtaattttcattgaagaccgtctaaaatttggtc |
278 |
Q |
| |
|
||||||||||||||||| || | | | |||||||||| ||||||||| || || |||||||| |||| | ||||||||||| ||| |||| | |||| |
|
|
| T |
7749355 |
gatggagttccaacagcagcagtaagtgaagccattgctgccttctctttctgcaatgctccgggtgcggtgttcattgaagatggtccaaaactgggtc |
7749256 |
T |
|
| Q |
279 |
cagctgaacc |
288 |
Q |
| |
|
|| ||||||| |
|
|
| T |
7749255 |
caactgaacc |
7749246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4741 times since January 2019
Visitors: 5752